Pathological investigation and molecular detection of bacterial zoonotic diseases of slaughtered cattle in Bangladesh

Table 1. Oligonucleotide primers used in PCR detection of zoonotic pathogens in slaughtered cattle.

Genes targeted	Primers	Primer sequence (5´-3´)	Organism	Amplicon size	Reference
16S rRNA	TB 1-F	gaacaatccggagttgacaa	M. tuberculosis complex	372 bp	[8]
	TB 1-R	agcacgctgtcaatcatgta
H37RvHP	H37RvHPF	gaactcaccgtcggtggtga	M. tuberculosis	667 bp	[9]
	H37RvHPR	ccttgctcgatctctgcgtc
MPB83	MPB83F	cagggatccaccatgttcttagcgggttg	M. bovis	600 bp	[10]
	MPB83R	tggcgaattcttactgtgccggggg
alkB	BrucF1	gatggacgaaacccatgaatg	B. abortus	621 bp	[11]
	BrucRI	cgatgccatcttgtggatgcc
HP	LeptF1	caattcaagacgctggagtg	L. interrogans serovar Hardjoprajitno	323 bp	[11]
	LeptR1	gtgccaagaccagggattc
InlC	LMF	aattcccacaggacacaacc	L. monocytogenes	517 bp	[12]
	LMR	aattcccacaggacacaacc